![]() Learn > 4k Blu-ray disc playing on PC?ĭownload and install ByteCopy: Windows version, Mac version This 4K Blu-ray Ripper is fully compatible with macOS 10.12 Sierra, OS X 10.11 El Capitan, OS X 10.10 Yosemite, OS X 10.9 Mavericks, OS X 10.8 Mountain Lion, OS X 10.7 Lion, OS X 10.6 Snow Leopard, OS X 10.5 Leopard, OS X 10.4 Tiger. The best 4K Blu-ray Ripper – Pavtube ByteCopy for Mac can easily help you remove 4K Blu-ray AACS, BD+, MKB V62, etc protection and convert Blu-ray to Mac supported digital formats. You also can choose to rip 4K Blu-ray to 4K MP4, 4K MKV, HD MP4, HD MOV, HD M4V for QuickTime playing on macOS Sierra, El Capitan. Method 2: Rip 4K Blu-ray to MP4/MOV for Mac Playback This blu ray player software also supports smart phones. This is also a powerful HD video player that doesn’t cause any loss to the picture and audio quality. It supports a vast range of video formats and MP3, AVI, WMV, WMA, MPEG, MP4 etc. It can play both commercial and non-commercial blu ray discs, folders and ISO files. This Blu-ray 4K player is the authorized player software. It costs around $100 and you can purchase it online as well. It comes in three versions and all the 3 versions have powerDVD remote that turns your android device into a remote control for the power DVD installed system. The latest version of it (Power DVD 15 Ultra) supports blu-ray, 4K, 3D, HD and various others formats of videos. This certainly is one of the best software programs for playing blu ray videos. VLC in version 2.1 has been updated to offer 4K playback, you can use VLC to play your favorite 4K movies. It also allows you to convert your files with limited output formats supported. It support for a very large range of codec, enabling you to play virtually multiple media formats. VLC media player is open-source multimedia solutions and a non-profit organization, not backed by any company, a well-known best free video player which gives you the ability to play media from your computer or a disk, or to stream it from the Web. Below are top 3 4K Blu-ray video players for Mac in 2017. Apart from 4K Blu-ray drive, you also need a 4K Blu-ray Player. Normally, Mac won’t equipped with a BD Drive. To play 4K Blu-ray disc on Mac (macOS Sierra), the very first thing you need to make clear is whether your computer has a BD drive. Read: Why Macs Never Support Blu-ray? Method 1: Play 4K Blu-ray on Mac with 4K Video Player and 4K External Blu-ray Drive Till now, there are two ways to play 4K Blu-ray on Mac including macOS Sierra. Many people are wandering how to play 4K Blu-ray disc on Mac, since there exist some differences between 4K Blu-ray disc and general Blu-ray disc. Ultra HD Blu-ray the latest generation of Blu-ray discs which, as the name suggests, supports Ultra HD – aka 4K. ![]() 08:39 am / Posted by Diana Joan | Categories: Blu-ray, NAS
0 Comments
The official ongoing list of fashion houses who make the cut is published here. However, even this most elite selection has its hierarchy - members are divided into "official" (French houses such as Chanel and Dior), "correspondent" (foreigners, most notably Armani and Valentino), "guest" (new talents), "jewelry" and "accessories". twice a year) present a collection to the Paris press, comprising at least thirty-five runs/exits with outfits for both daytime wear and evening wear.įashion houses meeting these rather challenging criteria (the second is particularly fantastic, I have an unflagging desire to visit an haute couture atelier and observe the dressmakers' meticulous work because I often feel like it is more interesting than the preceding design process) are selected each year by the Paris Chamber of Commerce and then become members of the Syndical Chamber for Haute Couture (Chambre syndicale de la haute couture). Have a workshop (atelier) in Paris that employs at least fifteen people full-time.Design made-to-order for private clients, with one or more fittings.To earn the right to call itself a couture house and to use the term haute couture in its advertising and any other way, a fashion house must follow these rules: So, then, what is haute couture in its narrowest sense?Īccording to Wikipedia, the term haute couture is protected by law in France and is defined by the Paris Chamber of Commerce (Chambre de commerce et d'industrie de Paris). Some fashion houses add to the confusion by falsely describing their special collections as "haute couture" you'd think they should be the first ones making sure the term is used properly, but fashion industry probably fuels the mystery behind these two words on purpose as to create more buzz. This isn't entirely incorrect, but it is a very loose interpretation of the term. The main misconception people have about the term haute couture is that it applies to all handmade and/or made-to-order garments, whether manufactured by seamstresses at Dior or aspiring fashion design students. They're hard to find in the States, got me feeling couture ![]() My boyfriend bought me a Hysteric Glamour shirt Some of the uninitiated toss it around relentlessly in an ungainly belief that peppering your language with "exotic" French expressions will make you sound smarter while others (ab)use it because haute couture collections are way fancier than ready-to-wear, so everything that's at least a bit fancy in the eye of the beholder automatically becomes "couture": Just last week, Cardi B made her catwalk debut in a floor-length, bright blue Balenciaga faux fur coat at the label’s pre-fall fashion show in Los Angeles.Haute couture is one of the most misused terms in fashion. Making the alternatives to fur desirable remains another challenge altogether, though progress is being made. Tireless PETA campaigning and gallons of red paint have finally swung the pendulum away from fur products even luxury conglomerate Kering - parent company to designer labels including Gucci, Yves Saint Laurent, Balenciaga and Bottega Veneta - phased out fur in 2022. Today, opting for the real deal will likely be seen as a reflection of personal ethics. In 1929, Vogue quipped that the fur you wore revealed, “the kind of woman you are and the kind of life you lead.” Almost a century later, it’s still true - though not in the way the magazine intended. Once upon a time, genuine animal fur was a coveted status symbol. ![]() The pink coat - a nod to Minaj's new album "Pink Friday 2" - was a Haute Couture look from Alexandre Vauthier. This would enable someone to quickly look at this section and see what’s going on by seeing the various heights of the bars, the eye could have quickly gauged the differences in tweets per second per event without having to read anything. Here, the tweets per second could have at least been shown in a bar graph. When you have an opportunity to display information visually, take it. What’s wrong with this infographic? It breaks the first rule right out of the gate. Take this portion of an infographic about Twitter by ViralMS as an example: This Twitter infographic writes out the data, rather than visualizing it. As an infographic designer, you may or may not determine the concept and compile all of the research for the final design, but either way you are responsible for turning that information into a visually stimulating, cohesive design that tells a story and that doesn’t miss a single opportunity to visualize data. The foundation of any good infographic is data viz. The same holds true for infographic design. ![]() Show, Don’t TellĪ rule of cinema is to show, don’t tell. Here are some simple rules to follow when wrapping your mind around proper data viz. But that mindset can be gained through practice and by sticking to certain standards, the most important of which is to respect and understand data viz. ![]() Creating infographics is a challenge and requires a mindset that does not come naturally to everyone. Even some of the best designers, with portfolios that would make you drool, cannot execute an effective infographic design. Wrapping Your Mind Around Data Viz And Infographic Designĭesigning an infographic is not the same as designing a website, flier, brochure, etc. This is why learning how to design a good infographic is a must, and avoiding the common pitfalls of infographic design could mean the difference between landing a big client and losing them entirely. Companies large and small are using infographics to build their brands, educate their audience and optimize their search engine ranking through link-building. ![]() With brands like USA Today, The New York Times and Google and even President Obama getting behind them, infographics are becoming a powerful tool for disseminating huge amounts of information to the masses. While some design trends come and go, infographics are here to stay. Today, infographics compile many different data visualizations into one cohesive piece of “eye candy.” They have evolved with design trends, received some creative facelifts, and the Internet is now getting filled with interesting information delivered in enthralling ways. Of course, just as Web 2.0 changed 1.0, today’s infographics are far more eye-catching than simple pie charts and bar graphs. In the simplest terms, infographics are not too different than the charts and graphs that programs like Excel have been spitting out for years. This visualization should not be left up to interpretation, it should instead be designed in a way that provides a universal conclusion for all viewers. The term “data viz” comes from “data visualization,” which implies that sets of data will be displayed in a unique way that can be seen, rather than read. Infographics are visual representations of information, or “ data viz” as the cool kids call it these days. Over the past two years, this fact has become the backbone of a growing trend in online marketing: the infographic. The Internet is a great designer’s playground, and online businesses are growing more and more appreciative of what can be gained from a bit of well-executed eye candy. ![]() From Web 1.0 to Web 2.0 and beyond, designers have remained on their toes as they define the trends and expectations of our online universe. Since the dawn of the Internet, the demand for good design has continued to skyrocket. This is why learning how to design a good infographic is a must, and avoiding the common pitfalls of infographic design could mean the difference between landing a big client and losing them entirely.Įditor’s Note: You might want to read Nathan Yau’s article The Do’s And Don’ts Of Infographic Design: Revisited here on Smashing Magazine which is a response to this article. Infographics iare becoming a powerful tool for disseminating huge amounts of information to the masses. ![]() For Fungi, we follow the Outline of Fungi classification with some modifications. UNITE uses Catalogue of Life for overall eukaryotic taxonomy and classification. Missing information is indicated as "unidentified" item “f_unidentified ” means that no family name for the sequence exists. k = kingdom p = phylum c = class o = order f = family g = genus s = species and sh = species hypotheses. This specifies the hierarchical classification of the sequence. In the corresponding text file, the classification string of the SH is found: SH1301637.09FU_FJ357315_refs k_Fungi p_Ascomycota c_Dothideomycetes o_Pleosporales f_Pleosporaceae g_Alternaria s_Alternaria_planifunda sh_SH1301637.09FU (reps = this is an automatically chosen RepS) Refs = this is a manually designated RefS SH1301637.09FU = accession number of the SH with 05 indicating the major version of the UNITE SHįJ357315 = GenBank/UNITE accession number of sequence chosen to represent the SH The syntax is the same throughout the three sets of files.Įach SH is given a stable name of the accession number type, here shown in the FASTA file of the dynamic set:ĬACAATATGAAGGCGGGCTGGCACTCCTTGAGAGGACCGGC… The third set of files is the result of a dynamic use of clustering thresholds, such that some SHs are delimited at the 3% distance level, some at the 2.5% distance level, some at the 2% distance level, and so on these choices were made manually by experts of those particular lineages of fungi. ![]() ![]() Three sets of QIIME files are released, corresponding to the SHs resulting from clustering at the 3% distance (97% similarity) and 1% distance (99% similarity) threshold levels. ![]() Luckily, this group is relatively limited. This next group of present participle verbs will have a stem change from “o” to “u”. These are verbs that lose the “e” altogether, just to not have two “i”s next to each other. In fact, within this group of stem-changing verbs, there’s a subgroup. As you keep studying Spanish, you’ll start realizing that – ir verbs are constantly the problematic group. Notice the pattern? They’re all -ir verbs. To make their present participle, all you need to do is remove the – ar, then add – ando to the ending. ![]() ar verbs are certainly the easiest of the whole list to do. Now, let’s look at how you can conjugate the present participle: Ar Verbs This is the famous -ing ending in English.īy adding these two Spanish verbs together, you form the present progressive tense. The present participle is also known as the gerund ( gerundio ). So with the verb estar in the present simple form, we then need to change the second verb to the present participle form. For example, the auxiliary verb haber is used in many other verb tenses, as well. There are lots of other examples of these types of verbs that you might be familiar with. So for the present progressive in Spanish, estar will function as an auxiliary verb. Here’s a quick rundown in case you need a reminder: Spanish Personal Pronouns You just have to conjugate the verb estar in the present tense. Since you need two verbs, let’s start with the first verb, estar. So today we’re going to dive in and explain everything you need to know about the Spanish present progressive. You’ll also see that the participle (the gerund form), can have other uses as well. In fact, this structure is the same as in English, so that should be easy to understand! The Spanish present progressive tense is used to describe events that are currently ongoing. To form the present progressive, you just need the verb “ estar ” and to conjugate a second verb. There are many of these types of phrases in Spanish. What is the present progressive?Īs we mentioned, the present progressive is a perífrasis verbal. So get out your notes, because today estás estudiando el gerundio. The Spanish present progressive is more or less the same as the English present continuous tense (to be doing), but you’re going to see that there are some minor differences to keep in mind. The present progressive tense, also known as a perífrasis verbal, is composed of two verbs that function as one. The present progressive in Spanish might seem a little daunting at first since you need to conjugate two different verbs to use it, but in reality, it’s one of the easiest tenses you’re going to learn! Supplementing the display area is a felt-lined drawer for more knives or other accessories, which rides on metal rails for smooth action. The clear case gives a 360-degree view of your collection and allows easy access by just lifting it off its hinge. Like their other cases, the Blade Deck has a display area front and center protected by a hinged acrylic case, with four slots able to accommodate up to four fixed blades of up to 9” in length. It continues the brand’s aim to provide top-tier storage and display solutions for all your everyday carry gear, focusing on larger-sized fixed blades you may have in your collection. Holme & Hadfield Launches the Blade Deck, Their Latest Display Caseĭecember 15, 2023: The Blade Deck is the latest display case and organizer in the sizable catalog of UK-based design studio Holme & Hadfield. The EDC33 is now available from Nitecore’s store at the link below. Purpose: Tactical, everyday carry, emergencies Other modern features include the use of more premium anodized 7075 aluminum for the body, a hardware lockout switch, a USB-C charging port with a rotary cover, and an optical sensor that automatically drops the output when it detects an obstruction at close range. ![]() One major feature that Nitecore emphasized is the “LUMIN SHIELD,” which sets the EDC33 on full 4,000-lumen output in a special full flood mode to create a “wall of light” as a deterrent in an emergency. Use of 18650 allows the light to be more compact while still having a substantial output. Key features of the EDC33 include a substantial 4,000-lumen output up to 492 yards thanks to a 9x array of NiteLab UHi 20 MAX LEDs–one of the first appearances of the LED on the mass market–powered by a newly developed 18650 Li-ion battery with an unprecedented 4,000mAH capacity, which is a fresh reversion from the industry leaning more towards larger batteries like the 21700. It brings together all of the brand’s experience in making lights across multiple applications and combines them into a modern tactical flashlight that utilizes the latest in battery, LED, and electronic technology. ![]() Nitecore's New EDC33 is a Throwback and a Leap Forward for Tactical Flashlightsĭecember 15, 2023: Nitecore, one of the leading flashlight manufacturers on the market with a deep and robust catalog of lights with a specialty in tactical applications, releases the EDC33, their latest feature-packed flashlight. ![]() ![]() It looks amazing with its dark varnish and is definitely one of the best-looking violins, not only on this list, but also probably in the world. 2- and 3-year-olds will begin to create music with some accuracy without live or recorded musical support. It is uncommon for beginners to end up with a violin too advanced for them it is too common for intermediate and advancing violinists to have violins below their skill. Next up is a violin that is a real beauty queen - the ADM Hand carved Wooden. The more sophisticated sound of higher quality violins is for the more advanced player. Please note that the age range depends very much on the size of the child, some youngsters are tiny at 9 or 10, some are much bigger at 5 or 6. A beginner needs a violin with a clear tone that is easy to play. Acoustic Violin Toy Adjustable String Simulation Musical Instrument Kid Gifts Music Instruments Adults Simulated Violin Creative Musical Toy Early Educational. 23 1/4 inches (591 mm) Adults and teenagers. Valencia 400 Violin Outfit Spruce top Ebony. Because of this, student violins also come in varied degrees of quality. Valencia 400 Violin Outfit Spruce top Ebony Fittings Size 3/4. Piano: The piano and keyboard have some of the same benefits as the violin. The use of a bow also helps teach children coordination. Twinkle Little Star, a common first song, doesn't need the type of violin that Mozart's later concertos require. Violin: This may not be your first thought for a preschooler, but the smaller size is manageable for younger children’s hand size and helps teach the basics in tone and pitch. As the student progresses the violin itself will begin the teach them intrinsic details about what a violin is meant to do. Learning activities for 3-year-olds are most fun when they are dressed up as family games, pretend plays, or become parts of our daily activities and observations. More important is the growth of their musical voice and ears. Here are 15 activities for 3-year-olds that are both fun and educational: 5 Fun Developmental Activities for 3-Year-Olds 1. This makes using a rental violin a good choice so that the student can use the optimal size as they grow physically. This wide range in size means that a student will have to replace the violin every 6 months to year or so. The violin is unique in that it is one of the few serious instruments that can be scaled down small enough for even a 3 year old to play. ![]() No support questions outside of the Daily Advice Thread.No posts that aren’t directly related to Apple or the Apple eco-system.No rude, offensive, or hateful comments.No editorialized link titles (use the original source's title if applicable).Posts must foster reasonable discussion.No memes, direct images or contextless image/video posts.If you have a tech or buying/selling-related question, please check out our Daily Advice Thread or r/AppleHelp! CommunityĪ more in-depth version of the rules can be found here If you've not quite got the cash together to be able to buy it today, there is a chance the deal will still be around passed Monday, but it can't be guaranteed.Welcome to r/Apple, the unofficial community for Apple news, rumors, and discussions. What I can say is that the deals we're seeing now are probably as good as they're going to get at this point, so if you see a good saving on a product you've been holding out for, then go for it. ![]() It's billing its M3 MacBook Pro discounts as 'holiday savings' without any specfic end date provided.Įven for deals that explicitly state 'Black Friday' or 'Cyber Monday', it's not entirely clear since most retailers started the sales early. Some of the best Apple Cyber Monday deals that we're seeing aren't officially billed as being either Black Friday or Cyber Monday, and some started weeks ago.įor example, B&H Photo does has some specific 'Cyber Monday' deals on its site with countdown timers on them, but some its Apple deals aren't included in these. When will Apple Cyber Monday deals end? To be honest, there's no telling in most cases. MacBook Air M2: $1,229 to $1,049 at Amazon right now.It's been at this price a few times lately, but I don't really see it dropping further. Is this the lowest price ever? I hear you ask. It's reduced $250 to $1,049 at Amazon right now. There's fortuitously a great deal on this model at the moment. True (and slightly dull) story.Īnyway, this isn't an advert, I'm just full of words (it is early evening, I'm not sure it'll be so true later). So light, in fact, I had to take my bag off my back to check I'd actually brought it the other day. As I'm often working at the kitchen table and I have small children, I don't always have the means to charge it (just think of the trip hazard!) – and I'm far too disorganised to remember to charge it before I need it. ![]() Most importantly though (for me) is the battery life. Its M2 chip means it's fast and responsive, and can handle my many, many tabs and even multiple Adobe software types at the same time. However, I'm typing this on my personal favourite of Apple's MacBooks. Apple Black Friday Quick Links Best Apple retailers in the USĮditor's picks: Our curated list of the best Apple deals right now Best Apple Black Friday US deals MacBooks enjoyed some lowest price ever situations, as did a couple of iPad models – and Apple Watch, too. We spent all weekend looking for cheap(er) Apple products and there were some record-low prices to be had, even if they weren't quite as low as we would have liked. However, a few are still lurking so take a look below for the verified offers still worth taking advantage of. ![]() Cyber Monday is over (thought there Cyber Week apparently happening) so most of the decent deals we've seen have disappeared now. Subwoofer line output: This feature makes it much easier for you to add more bass by connecting a powered subwoofer to your system-an appealing idea, considering that some of these amps aren’t powerful enough to produce much deep bass.Many amps add digital inputs for use with TV sets, computers, and CD players, and some include Wi-Fi streaming support. You can also connect more modern devices such as an Amazon Echo Dot or a Wi-Fi streamer. Connection options: All the models we tested for our latest update let you stream via Bluetooth and connect old-school analog-output audio devices such as turntables (although you may have to add a phono preamp), cassette decks, and CD players.We considered amps of all power ratings because our previous tests showed that even those models with the weakest power ratings were adequate for typical home listening levels. Power rating: This is the first spec most people consider when buying an amp or receiver.Above that price, we would have been getting more into amplifiers and receivers designed for audio enthusiasts, who may have technical demands and brand preferences that go beyond the scope of a guide like this. Selecting a region changes the language and/or content on. He also looks out for “the honkiness factor,” when voices sound too nasal, which can come into play between 600 and 800 Hz. When he’s recording vocals, Berry monitors between 20 Hz and cuts a little if it seems harsh. “If you pull down your highs,” she says, “there’s always the risk of losing the clarity of a person’s voice. The human voice exists mostly between 10 Hz, but sibilance and consonant sounds can reach higher frequencies. Boutillette, a frequent podcast producer, cautions against setting a low-pass filter too low. When mixing drum tracks, Berry uses low-pass filters to avoid snare or symbol bleed. “Even though you don’t hear it, it’s still making the speakers work harder than they have to.” When he’s mixing a vocal track, he tends to filter out everything below 100 Hz: “The microphone might pick up some subsonic frequencies, and that’s just going to muddy up your mix,” he says. “We can’t really hear them well anyway, and they can get out of hand and start rumbling your room,” she says. Producer and mixer Lo Boutillette uses high-pass filters to cut the low basses. A high-pass filter cuts the low frequencies and lets high frequencies pass through, while a low-pass filter does the opposite. These filters are important tools in any good EQ plug-in. ![]() If you cut something and all the beefiness to the sound just goes away, you may want to keep that in or even boost it a little more.” If you boost something and don’t like how it sounds, you can cut it a little bit. “You can either go up or go down on one of the fixed frequency points. “The cool thing about graphic EQs is how simple they are,” says producer and engineer Gus Berry. This makes for easy cutting and boosting, but you risk altering frequencies that you aren’t trying to alter. On a 10-band EQ, the center frequencies are an octave apart, so each adjustment covers a whole octave of tones. With so many bands to work with, you can adjust narrow ranges of frequency. On a 31-band graphic equalizer, the center frequency of each band is one-third of an octave away from the center frequencies of adjacent bands. The most sensitive human ears can hear roughly between 20 and 20,000 Hz.) Low notes travel in slow waves, high in fast. (Frequency - the rate at which a sound wave passes a certain point - is measured in hertz (Hz), which is the number of waves that pass a point in one second. If the bass is shaking the windows, you can just lower the slider of one of the lower frequency bands. If, for example, the treble is too loud on a track, cutting the volume on one or two of the higher frequency bands can soften it. ![]() Most graphic equalizers divide sound between 6 and 31 bands of frequency, with a physical or virtual slider controlling the volume of each band. ![]() ![]() To use it, you just need to right-click on a file and it will offer you an option to erase the data. With its easy-to-use interface, you can schedule deletion whenever you want. Also, in contrast to CCleaner, which has had problems with viruses, Eraser is completely safe to download. With Secure Online Ordering you will receive your license key via email in a few minutes using your credit card! We strongly recommend you to use the Secure Online Ordering. Eraser focuses only on the removal of trace elements.
|
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |