If you’re travelling to the Grand Canyon, consider stopping in Sedona on the way.
0 Comments
![]() These worlds are created by other users and offer a unique experience. Exploring Virtual Worlds: VR Chat has a range of virtual worlds that users can explore.Here are some of the gameplay options available in VR Chat: VR Chat offers a range of gameplay options, from exploring virtual worlds to playing mini-games with other users. Users who violate these standards can face the consequences, including account suspension or ban. These standards include guidelines on behavior, language, and content. Community Standards: VR Chat has a set of community standards that users are expected to follow.These events provide a platform for users to interact with each other and showcase their creativity. Events: The VR Chat community hosts a range of events, including concerts, parties, and game shows.Users often create custom avatars, virtual worlds, and games that other users can explore. Content Creation: The VR Chat community is known for its content creation.Here are some of the notable aspects of the VR Chat community: The community is known for its creativity and humor users often create unique and entertaining content. The VR Chat community is vibrant and diverse, with users from all over the world. Emotes are animations that can be triggered by typing certain commands in the chat window. Emotes: VR Chat allows users to use emotes to express themselves.Each world has its own theme and gameplay, providing a unique experience for users. ![]() Virtual Worlds: VR Chat offers a range of virtual worlds that users can explore.Users can talk to each other using their microphones, or they can type messages using the chat window. Voice Chat: VR Chat has a built-in voice chat system that enables users to communicate with each other in real time.This feature allows users to express their creativity and stand out in the crowd. Users can choose from a range of pre-made avatars or create their own using the built-in avatar editor. Custom Avatars: VR Chat allows users to create and customize their avatars.Here are some of the notable features of VR Chat: VR Chat offers several features that make it a unique and engaging social platform. The platform has gained popularity in recent years, attracting millions of users from around the world. Virtual Reality (VR) Chat is an online social platform that allows users to interact with each other in a virtual environment. These websites allow users to filter skins based on popularity, date uploaded, and other criteria. Some popular third-party websites include VRCMods and Booth. ![]() Users can browse these websites to find a skin they like, download it, and import it into VR Chat. Third-party websites offer a vast selection of VR Chat skins. They can also ask for recommendations from other users in the community. Users can join the server and browse the different channels dedicated to avatars. The VR Chat Discord server is another great resource for finding skins. The website also has a search feature that allows users to filter skins based on their preferences. The VR Chat Community website has a dedicated section for avatars where users can browse a wide range of skins. The VR Chat Community website and Discord server are excellent resources for finding new skins. They can adjust the size and shape of various body parts, such as the head, arms, and legs.ĭownloading Skins from the VR Chat Community
![]() ![]() ![]() Version management: It supports Git, Mercurial, Bazaar, and Subversion and can simply inspect, commit, and push changes.Comparing folders: It drills down into a file comparison for a complete view of differences to identify and manage missing or updated files across folders.In addition, a Three-way merge helps with dispute resolution and base version display. You may also move between changes and perform operations on change blocks. Comparison of files: It can use real-time comparison updates to compare, modify, and combine files.You might even be able to use it to unravel the mystery of the merging you keep avoiding. You may evaluate code changes and comprehend fixes with its assistance. It supports several well-known version control systems and offers two- and three-way comparisons of files and directories. You can compare files, folders, and projects with version control using Meld. 01 MeldĬompared to Windows 10, Meld is a well-known free, open-source folder compare utility (Also available for Linux). We've produced a brief selection in this post to provide an overview of the best folder compare tools for Windows and Mac. It makes changes apparent and aids in their comprehension. This is where a folder compare utility will help. Keeping track of a software, writing, or design project is difficult, especially when multiple users are involved. Best Folder Compare Tool for Windows/Mac Online To assist you, we've included the top folder comparison tools below. However, hundreds of folder comparison tools are available online, making it difficult to choose one. These tools assist you in organizing your storage and locating unnecessary files on your computer. Using the folder compare tools, you can use folder compare online. I hope I am building the legacy of a strong writer/poet and performer. So, we wanted to encourage conversations on the topic of legacy and you’ll find highlights from our conversation from some wonderful members of the business and creative community below. Psylocke (played by actress Mei Melancon), a mutant who possesses psionic powers, from “X-Men: The Last Stand” (2006).When we go on short trips we often know exactly what we expect at the end, but when it comes to our lives and careers we’ve seen far too often we shy away from really thinking through where we expect to be at the end and what we hope our legacy will be. Michelle (played by actress Bai Ling), an assasin with a heart of gold, from “The Gene Generation” (2007). Yukio (played by actress Shiori Kutsuna), a female ninja, from “Deadpool 2” (2018). From left to right: Two fabricants (clones) from “Cloud Atlas” (2012). In science fiction movies, a colored hair swish is usually associated with a character that is ambiguous in some way. The swish() activation function is named for its shape. There are significant new developments, such as the use of the swish() activation function, being discovered all the time. The field of machine learning is very excting. So, swish() worked fine, and I beleive the research claims that swish() is superior to relu() and tanh() for very deep NNs. But when I used a learning rate of 0.02 with swish(), I got essentially the same results. Compared to the NN with tanh() and a learning rate of 0.01, the swish() version learned a bit slower. I took an existing 6-(10-10)-3 classifier I had, which used tanh() on the two hidden layers, and replaced tanh() with swish(). The demo run on the right uses swish() activation with a LR = 0.02. The demo run on the left uses tanh() activation with a LR = 0.01. So, adding what are essentially unnecessary functios to PyTorch can have a minor upside. But if swish() had been in PyTorch I would have discovered it earlier. Adding such a trivial function just bloats a large library even further. The fact that PyTorch doesn’t have a built-in swish() function is interesting. Update: I just discovered that PyTorch 1.7 does have a built-in swish() function. Z = self.oupt(z) # no softmax for multi-class # z = T.tanh(self.hid1(x)) # replace tanh() w/ swish() However, it’s trivial to implement inside a PyTorch neural network class, for example: At the time I’m writing this bog post, Keras and TensorFlow have a built-in swish() function (released about 10 weeks ago), but the PyTorch library does not have a swish() function. The Wikipedia entry on swish() points out that swish() is sometimes called sil() or silu() which stands for sigmoid-weighted linear unit. The three related activation functions are: It’s sort of a cross between logistic sigmoid() and relu(). I made this graph of sigmoid(), swish(), and relu() using Excel. The swish() function was devised in 2017. ![]() Many variations of relu() followed but none were consistently better so relu() has been used as a de facto default since about 2015. Then relu() was found to work better for deep neural networks. In the early days of NNs, logistic sigmoid() was the most common activation function. I don’t know Thorsten personally, but he seems like a very bright and creative guy. My thanks to fellow ML enthusiast Thorsten Kleppe for pointing swish() out to me when he mentioned the similarity between swish() and gelu() in a Comment to an earlier post. I was recently alerted to the new swish() activation function for neural networks. It’s very difficult, but fun, to keep up with all the new ideas in machine learning. 10, as jury selection was about to begin in Haynes’ trial, the prosecution and defense agreed to a plea bargain requiring Haynes to serve 180 days in county jail, perform 300 hours of community service (with an emphasis on cycling-related education), relinquish his commercial license for five years, and pay a $500 fine. The last issue of BikeTexas Today featured on its cover a photograph of nationally known marathon cyclist Larry Schwartz, who was killed in a collision involving bus driver Robert Arvard Haynes. Originally published: BikeTexas Today April – May 2004 In lieu of gifts and flowers, BikeTexas / Texas Bicycle Coalition and The Crohn’s and Colitis Foundation of America were designated as recipients for memorial contributions.īus Driver Pleads Guilty in Schwartz Death Larry became a BikeTexas member in 1991 and made a generous donation to the Education Fund last Fall. A common theme in 21 pages of guestbook entries is Larry’s humble nature despite his amazing achievements. As evident when viewing the Dallas Morning News “Larry Schwartz guestbook” Larry’s life and sudden passing have touched cyclists across the continent. ![]() ![]() Larry’s love of cycling and his involvement in the cycling community cannot be overemphasized. Larry was fatally hit when the mirror of a passing school bus struck him from behind north of McKinney on FM 1461 around 8 a.m. In 2002 Larry cycled approximately 25,000 miles and in 2003 he had already cycled 7,612. Larry was featured in our March-April issue of BikeTexas Today and recognized in the Dallas Morning News for his prolific cycling. Lawrence “Larry” Schwartz was born January 5, 1961, in Washington, D.C. Originally published: BikeTexas Today February – March 2003 Texas Trails & Active Transportation Conference.College Active Transportation Safety (CATS). ![]()
![]() Avenir has physical features such as thicker stroke verticals than horizontals, classically drawn lowercase, short ascenders to aid in legibility, and a small x-height. They first appeared in the early 1920s and are characterized by geometric construction suggesting use of a compass. Sans-serif typefaces like Avenir that use minimal geometric forms are called geometric san-serifs. Avenir was used by many famous companies and brands in their products, such as Apple, Snapchat, Bloomberg, Disney+, the BBC, Best Buy, Toyota, Land Rover, etc. In 2014, French railway company SNCF used Avenir for communication and advertising. In 2012, François Hollande used Avenir in his campaign materials during the 2012 French presidential election. ![]() In 2003, the City of Amsterdam began using Avenir as the principal typeface in its corporate identity, including the famous “I Amsterdam” sign. Avenir means “future” in French and hints that the typeface owes some of its interpretation to Futura. ![]() The typeface family was later expanded to six weights, each with a roman and an oblique version.įrutiger considers Avenir to be his best work and intends it to be a more human version of geometric sans-serif typefaces popular in the 1930s, such as Futura (1927) designed by Paul Renner and Erbar (1922) designed by Jakob Erbar. It was released in 1988 by Linotype GmbH with three weights, each with a roman and an oblique version, and used Frutiger’s two-digit weight and width convention for names. So I combined the words “next” and “future” to get this subtitle.Īvenir is a geometric sans-serif typeface designed by the Swiss typeface designer Adrian Frutiger (1928–2015) in the late 20th century. The result was titled “Avenir Next” and the Avenir word means “future” in French. I used the subtitle “The Next Future” for the Avenir typeface because Adrian Frutiger reworked the Avenir family to expand the range of weights and features. ![]() Learn > 4k Blu-ray disc playing on PC?ĭownload and install ByteCopy: Windows version, Mac version This 4K Blu-ray Ripper is fully compatible with macOS 10.12 Sierra, OS X 10.11 El Capitan, OS X 10.10 Yosemite, OS X 10.9 Mavericks, OS X 10.8 Mountain Lion, OS X 10.7 Lion, OS X 10.6 Snow Leopard, OS X 10.5 Leopard, OS X 10.4 Tiger. The best 4K Blu-ray Ripper – Pavtube ByteCopy for Mac can easily help you remove 4K Blu-ray AACS, BD+, MKB V62, etc protection and convert Blu-ray to Mac supported digital formats. You also can choose to rip 4K Blu-ray to 4K MP4, 4K MKV, HD MP4, HD MOV, HD M4V for QuickTime playing on macOS Sierra, El Capitan. Method 2: Rip 4K Blu-ray to MP4/MOV for Mac Playback This blu ray player software also supports smart phones. This is also a powerful HD video player that doesn’t cause any loss to the picture and audio quality. It supports a vast range of video formats and MP3, AVI, WMV, WMA, MPEG, MP4 etc. It can play both commercial and non-commercial blu ray discs, folders and ISO files. This Blu-ray 4K player is the authorized player software. It costs around $100 and you can purchase it online as well. It comes in three versions and all the 3 versions have powerDVD remote that turns your android device into a remote control for the power DVD installed system. The latest version of it (Power DVD 15 Ultra) supports blu-ray, 4K, 3D, HD and various others formats of videos. This certainly is one of the best software programs for playing blu ray videos. VLC in version 2.1 has been updated to offer 4K playback, you can use VLC to play your favorite 4K movies. It also allows you to convert your files with limited output formats supported. It support for a very large range of codec, enabling you to play virtually multiple media formats. VLC media player is open-source multimedia solutions and a non-profit organization, not backed by any company, a well-known best free video player which gives you the ability to play media from your computer or a disk, or to stream it from the Web. Below are top 3 4K Blu-ray video players for Mac in 2017. Apart from 4K Blu-ray drive, you also need a 4K Blu-ray Player. Normally, Mac won’t equipped with a BD Drive. To play 4K Blu-ray disc on Mac (macOS Sierra), the very first thing you need to make clear is whether your computer has a BD drive. Read: Why Macs Never Support Blu-ray? Method 1: Play 4K Blu-ray on Mac with 4K Video Player and 4K External Blu-ray Drive Till now, there are two ways to play 4K Blu-ray on Mac including macOS Sierra. Many people are wandering how to play 4K Blu-ray disc on Mac, since there exist some differences between 4K Blu-ray disc and general Blu-ray disc. Ultra HD Blu-ray the latest generation of Blu-ray discs which, as the name suggests, supports Ultra HD – aka 4K. ![]() 08:39 am / Posted by Diana Joan | Categories: Blu-ray, NAS The official ongoing list of fashion houses who make the cut is published here. However, even this most elite selection has its hierarchy - members are divided into "official" (French houses such as Chanel and Dior), "correspondent" (foreigners, most notably Armani and Valentino), "guest" (new talents), "jewelry" and "accessories". twice a year) present a collection to the Paris press, comprising at least thirty-five runs/exits with outfits for both daytime wear and evening wear.įashion houses meeting these rather challenging criteria (the second is particularly fantastic, I have an unflagging desire to visit an haute couture atelier and observe the dressmakers' meticulous work because I often feel like it is more interesting than the preceding design process) are selected each year by the Paris Chamber of Commerce and then become members of the Syndical Chamber for Haute Couture (Chambre syndicale de la haute couture). Have a workshop (atelier) in Paris that employs at least fifteen people full-time.Design made-to-order for private clients, with one or more fittings.To earn the right to call itself a couture house and to use the term haute couture in its advertising and any other way, a fashion house must follow these rules: So, then, what is haute couture in its narrowest sense?Īccording to Wikipedia, the term haute couture is protected by law in France and is defined by the Paris Chamber of Commerce (Chambre de commerce et d'industrie de Paris). Some fashion houses add to the confusion by falsely describing their special collections as "haute couture" you'd think they should be the first ones making sure the term is used properly, but fashion industry probably fuels the mystery behind these two words on purpose as to create more buzz. This isn't entirely incorrect, but it is a very loose interpretation of the term. The main misconception people have about the term haute couture is that it applies to all handmade and/or made-to-order garments, whether manufactured by seamstresses at Dior or aspiring fashion design students. They're hard to find in the States, got me feeling couture ![]() My boyfriend bought me a Hysteric Glamour shirt Some of the uninitiated toss it around relentlessly in an ungainly belief that peppering your language with "exotic" French expressions will make you sound smarter while others (ab)use it because haute couture collections are way fancier than ready-to-wear, so everything that's at least a bit fancy in the eye of the beholder automatically becomes "couture": Just last week, Cardi B made her catwalk debut in a floor-length, bright blue Balenciaga faux fur coat at the label’s pre-fall fashion show in Los Angeles.Haute couture is one of the most misused terms in fashion. Making the alternatives to fur desirable remains another challenge altogether, though progress is being made. Tireless PETA campaigning and gallons of red paint have finally swung the pendulum away from fur products even luxury conglomerate Kering - parent company to designer labels including Gucci, Yves Saint Laurent, Balenciaga and Bottega Veneta - phased out fur in 2022. Today, opting for the real deal will likely be seen as a reflection of personal ethics. In 1929, Vogue quipped that the fur you wore revealed, “the kind of woman you are and the kind of life you lead.” Almost a century later, it’s still true - though not in the way the magazine intended. Once upon a time, genuine animal fur was a coveted status symbol. ![]() The pink coat - a nod to Minaj's new album "Pink Friday 2" - was a Haute Couture look from Alexandre Vauthier. This would enable someone to quickly look at this section and see what’s going on by seeing the various heights of the bars, the eye could have quickly gauged the differences in tweets per second per event without having to read anything. Here, the tweets per second could have at least been shown in a bar graph. When you have an opportunity to display information visually, take it. What’s wrong with this infographic? It breaks the first rule right out of the gate. Take this portion of an infographic about Twitter by ViralMS as an example: This Twitter infographic writes out the data, rather than visualizing it. As an infographic designer, you may or may not determine the concept and compile all of the research for the final design, but either way you are responsible for turning that information into a visually stimulating, cohesive design that tells a story and that doesn’t miss a single opportunity to visualize data. The foundation of any good infographic is data viz. The same holds true for infographic design. ![]() Show, Don’t TellĪ rule of cinema is to show, don’t tell. Here are some simple rules to follow when wrapping your mind around proper data viz. But that mindset can be gained through practice and by sticking to certain standards, the most important of which is to respect and understand data viz. ![]() Creating infographics is a challenge and requires a mindset that does not come naturally to everyone. Even some of the best designers, with portfolios that would make you drool, cannot execute an effective infographic design. Wrapping Your Mind Around Data Viz And Infographic Designĭesigning an infographic is not the same as designing a website, flier, brochure, etc. This is why learning how to design a good infographic is a must, and avoiding the common pitfalls of infographic design could mean the difference between landing a big client and losing them entirely. Companies large and small are using infographics to build their brands, educate their audience and optimize their search engine ranking through link-building. ![]() With brands like USA Today, The New York Times and Google and even President Obama getting behind them, infographics are becoming a powerful tool for disseminating huge amounts of information to the masses. While some design trends come and go, infographics are here to stay. Today, infographics compile many different data visualizations into one cohesive piece of “eye candy.” They have evolved with design trends, received some creative facelifts, and the Internet is now getting filled with interesting information delivered in enthralling ways. Of course, just as Web 2.0 changed 1.0, today’s infographics are far more eye-catching than simple pie charts and bar graphs. In the simplest terms, infographics are not too different than the charts and graphs that programs like Excel have been spitting out for years. This visualization should not be left up to interpretation, it should instead be designed in a way that provides a universal conclusion for all viewers. The term “data viz” comes from “data visualization,” which implies that sets of data will be displayed in a unique way that can be seen, rather than read. Infographics are visual representations of information, or “ data viz” as the cool kids call it these days. Over the past two years, this fact has become the backbone of a growing trend in online marketing: the infographic. The Internet is a great designer’s playground, and online businesses are growing more and more appreciative of what can be gained from a bit of well-executed eye candy. ![]() From Web 1.0 to Web 2.0 and beyond, designers have remained on their toes as they define the trends and expectations of our online universe. Since the dawn of the Internet, the demand for good design has continued to skyrocket. This is why learning how to design a good infographic is a must, and avoiding the common pitfalls of infographic design could mean the difference between landing a big client and losing them entirely.Įditor’s Note: You might want to read Nathan Yau’s article The Do’s And Don’ts Of Infographic Design: Revisited here on Smashing Magazine which is a response to this article. Infographics iare becoming a powerful tool for disseminating huge amounts of information to the masses. ![]() For Fungi, we follow the Outline of Fungi classification with some modifications. UNITE uses Catalogue of Life for overall eukaryotic taxonomy and classification. Missing information is indicated as "unidentified" item “f_unidentified ” means that no family name for the sequence exists. k = kingdom p = phylum c = class o = order f = family g = genus s = species and sh = species hypotheses. This specifies the hierarchical classification of the sequence. In the corresponding text file, the classification string of the SH is found: SH1301637.09FU_FJ357315_refs k_Fungi p_Ascomycota c_Dothideomycetes o_Pleosporales f_Pleosporaceae g_Alternaria s_Alternaria_planifunda sh_SH1301637.09FU (reps = this is an automatically chosen RepS) Refs = this is a manually designated RefS SH1301637.09FU = accession number of the SH with 05 indicating the major version of the UNITE SHįJ357315 = GenBank/UNITE accession number of sequence chosen to represent the SH The syntax is the same throughout the three sets of files.Įach SH is given a stable name of the accession number type, here shown in the FASTA file of the dynamic set:ĬACAATATGAAGGCGGGCTGGCACTCCTTGAGAGGACCGGC… The third set of files is the result of a dynamic use of clustering thresholds, such that some SHs are delimited at the 3% distance level, some at the 2.5% distance level, some at the 2% distance level, and so on these choices were made manually by experts of those particular lineages of fungi. ![]() ![]() Three sets of QIIME files are released, corresponding to the SHs resulting from clustering at the 3% distance (97% similarity) and 1% distance (99% similarity) threshold levels. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |